What will be the corresponding sequence in its original genome?
A retrovirus with a reverse transcriptase enzyme infects a eukaryotic cell and forms a protein whos RNA reads as 5' AUCGACGAUACGAAAGCCGUACGGCUAU 3'.
A retrovirus with a reverse transcriptase enzyme infects a eukaryotic cell and forms a protein whos RNA reads as 5' AUCGACGAUACGAAAGCCGUACGGCUAU 3'.
1 Answer
Feb 22, 2018
#5' AUCGACGAUACGAAAGCCGUACGGCUAU 3'
Explanation:
The original RNA sequence and the transcribed mRNA will have the same genetic sequence.
A retrovirus contains positive-sense RNA, which is transcribed into DNA by reverse transcriptase, which then is integrated into the host cell genome inside the nucleus by the enzyme integrase. It is then transcribed into mRNA, which leaves the nucleus and is translated into viral proteins, which then are assembled into new viruses.
